14851   Ccl22     Status: ES cell colonies screened / QC positives

GeneCcl22
Chromosome8
Deletion Start97,269,617
Deletion End97,273,875
Deletion Size4,259
Genome Build37
MGI IDMGI:1306779
NCBI Gene ID20299
BAC ID294L15
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 8

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF97,269,70497,269,724GAGGGTGGAGACCAGAGAATC
TUP97,269,72597,269,751TGGAAAGAGTCCAAGAGTGAGTCTGCC
TUR97,269,76897,269,791GGAAGTGCCAGAGTTAGTCCAAAG
TDF97,273,45497,273,475GCCCTTAGTAGTGTCTGCTTTC
TDP97,273,47797,273,504TGAGCAGATCGGTATGTATCTAGACGGC
TDR97,273,58397,273,603GCTCCTTGTTAGCAAGTCAGC

PCR Primers

PrimerSequence
SUTGTCCTTATCCATGTGCCAG
SDATGCCCACTGGGACTGATAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR88 bp++-
TDFTDR150 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14851B-G2VGB6C57BL/6NTac
14851B-D3VGB6C57BL/6NTac