14936   Oaf     Status: ES cell colonies screened / QC positives

GeneOaf
Chromosome9
Deletion Start43,047,653
Deletion End43,030,615
Deletion Size17,039
Genome Build37
MGI IDMGI:94852
NCBI Gene ID102644
BAC ID395E9
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 9

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF43,047,01443,047,034GAAATCCACAGGTGGCAAGAG
TUP43,046,98743,047,011CCTTGGGCTCTCCCTGTTGTGTTGG
TUR43,046,95943,046,980CAGCGGAGTAAGGGAAACTAAC
TDF43,030,81643,030,838GAAAGCCCTGTACTTGCCACTAC
TDP43,030,79143,030,815AGTCTGAGCCTGGCCTGGTACCCAT
TDR43,030,72943,030,747GCTTCGGATGCCACACTTG

PCR Primers

PrimerSequence
SUAAAAGTGCTGAACGGAGTCC
SDCAGCTGTCCCTCTCTGGTTC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR76 bp++-
TDFTDR110 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
14936A-B9VGB6C57BL/6NTac
14936A-G3VGB6C57BL/6NTac
14936A-H1VGB6C57BL/6NTac
14936A-H2VGB6C57BL/6NTac
14936A-H10VGB6C57BL/6NTac
14936A-D3VGB6C57BL/6NTac
14936A-A1VGB6C57BL/6NTac