15066   P2rx7     Status: ES cell colonies screened / QC positives

GeneP2rx7
Chromosome5
Deletion Start123,094,086
Deletion End123,123,822
Deletion Size29,737
Genome Build37
MGI IDMGI:1339957
NCBI Gene ID18439
BAC ID220L19
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 5

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFGGGAACCTGGGAGACACAG
TUPCAACACCCTGGGCTCCCACAGAG
TURTCAGAGCCCACAAGGGAAATC
TDFCACTGAGTTATGCTTCCTGCTCTG
TDPTCAGGGAGGAAAATTTGACATCATCCAGC
TDRCTGCCCCAAGCAAGATCAC

PCR Primers

PrimerSequence
SUATGCCCATCTTCTGAACACC
SDCTTCCCTGAAGCCATTGTGC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
15066A-F4VGB6C57BL/6NTac
15066A-F8VGB6C57BL/6NTac
15066A-C5VGB6C57BL/6NTac