15078   O3far1     Status: ES cell colonies screened / QC positives

GeneO3far1
Chromosome19
Deletion Start38,171,620
Deletion End38,188,586
Deletion Size16,967
Genome Build37
MGI IDMGI:2147577
NCBI Gene ID107221
BAC ID236O21
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 19

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF38,171,68138,171,700GCACCCACTTCCCTTTCTTC
TUP38,171,70138,171,722TCGGATGTCAAGGGCGACCACC
TUR38,171,72838,171,746TCTCCACGACGCTCAACAC
TDF38,188,10938,188,127CGAAAGCATCGCGGAAGAG
TDP38,188,13138,188,156TACGCTGAGCTTGGCATACTCTGAGA
TDR38,188,18338,188,200GCGGAAGAGTCGGTAGTC

PCR Primers

PrimerSequence
SUTTAAGAGCACTTAGACTGCC
SDAGCCACACTACGATTGAGCC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR66 bp++-
TDFTDR92 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
15078A-A9VGB6C57BL/6NTac
15078B-F5VGB6C57BL/6NTac
15078C-H7VGB6C57BL/6NTac