15164   Cdh23     Status: ES cell colonies screened / QC positives

GeneCdh23
Chromosome10
Deletion Start60,120,078
Deletion End60,112,843
Deletion Size7,236
Genome Build37
MGI IDMGI:1890219
NCBI Gene ID22295
BAC ID174O15
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 10

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF60,120,05460,120,076GTACTCCCTGGTCACTTGCTATG
TUP60,120,02960,120,052TGTGCTCTGGCTTCTCATGCTGGT
TUR60,119,97860,119,999GCACTGGCTGGCATTATCAAAG
TDF60,113,05060,113,068CCAGTGCTCAGCAGCTATC
TDP60,113,02660,113,049TGTGGCCAACCTGACTGTCTTGGG
TDR60,112,96460,112,988ACATATCCTACAGAGTGACACAGAG

PCR Primers

PrimerSequence
SUTGTTGGATCTGCGTTCAGAG
SDCTTGGAGCAGAAGAGAAGTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR99 bp++-
TDFTDR105 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
15164A-B8VGB6C57BL/6NTac
15164A-D4VGB6C57BL/6NTac
15164A-G5VGB6C57BL/6NTac
15164A-H1VGB6C57BL/6NTac
15164A-D11VGB6C57BL/6NTac
15164A-F12VGB6C57BL/6NTac