15335   Wars2     Status: ES cell colonies screened / QC positives

GeneWars2
Chromosome3
Deletion Start98,991,656
Deletion End98,945,025
Deletion Size46,632
Genome Build37
MGI IDMGI:1917810
NCBI Gene ID70560
BAC ID326M9
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 3

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF98,945,57098,945,589CGGTGCTCGGTGATCCTTAG
TUP98,945,59498,945,618CTGCATCTACCAGGCCCTGTAACCA
TUR98,945,64498,945,663GCCAGGCAAGCAACACTATG
TDF98,991,43798,991,457CAGCCTACAGGAATCCTCCAC
TDP98,991,45998,991,485TGGGAAATTACCTTGGAGCCATCGAGA
TDR98,991,51898,991,539GGTCCACGATGCTGTATATCAC

PCR Primers

PrimerSequence
SUTTTGCCAGAATCATTGACTGC
SDATTGGTCACACAATTCACTCC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR94 bp++-
TDFTDR103 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
15335A-A7VGB6C57BL/6NTac
15335A-C8VGB6C57BL/6NTac