15394   Kctd10     Status: ES cell colonies screened / QC positives

GeneKctd10
Chromosome5
Deletion Start114,830,434
Deletion End114,815,597
Deletion Size14,838
Genome Build37
MGI IDMGI:2141207
NCBI Gene ID330171
BAC ID380F24
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 5

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF114,829,882114,829,905GCACCTGGATACCTACCTAATCAC
TUP114,829,853114,829,876TTGAGGCCCTAGGTGACCACACCT
TUR114,829,811114,829,832CCCATAACGCAGACAGCAACAG
TDF114,816,499114,816,520GAGGCTTTGGGAGATGTGGTTC
TDP114,816,476114,816,498CATGGGATCCTGGAGCTGGCAAC
TDR114,816,422114,816,441TGAGGTGGCTCAGAGGGTAG

PCR Primers

PrimerSequence
SUTGGGACTAAACGCCTGACTC
SDAGGAGAGCAAAGACTGCCTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR95 bp++-
TDFTDR99 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
15394A-C8VGB6C57BL/6NTac
15394A-G12VGB6C57BL/6NTac