15470   Hmx3     Status: ES cell colonies screened / QC positives

GeneHmx3
Chromosome7
Deletion Start138,688,160
Deletion End138,686,480
Deletion Size1,681
Genome Build37
MGI IDMGI:107160
NCBI Gene ID15373
BAC ID267B14
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 7

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF138,686,973138,686,991CGACACCTGCCAACCAGAG
TUP138,686,994138,687,020TTGGTTAACTTCCTTCGGCCTCTAGCC
TUR138,687,023138,687,041GAGCGGCGCAGGAAAGATG
TDF138,687,876138,687,894CACCGAGACGCAGGTCAAG
TDP138,687,897138,687,919CTGGTTCCAGAATCGCCGCAACA
TDR138,688,003138,688,023CGCAGAGTTCTCGTGGTAGAG

PCR Primers

PrimerSequence
SUCATCATTAGCATCCGGCG
SDCTCAGAGCCACAGAGCAATG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR69 bp++-
TDFTDR148 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
15470A-H4VGB6C57BL/6NTac
15470A-G5VGB6C57BL/6NTac
15470A-B8VGB6C57BL/6NTac
15470A-F1VGB6C57BL/6NTac
15470A-D7VGB6C57BL/6NTac
15470A-B1VGB6C57BL/6NTac