16218   1110038F14Rik     Status: ES cell colonies screened / QC positives

Gene1110038F14Rik
Chromosome15
Deletion Start76,780,889
Deletion End76,779,242
Deletion Size1,648
Genome Build37
MGI IDMGI:2152337
NCBI Gene ID117171
BAC ID297G20
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 15

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF76,779,42576,779,444GCGCTGAAGGTATGGGAGTG
TUP76,779,44876,779,468TCTGCGGGACCCTGTTACCCA
TUR76,779,48576,779,502TCCGCCTGGGACAGAAAG
TDF76,780,70976,780,730GTGAGGCCACCAGAAAGAAGAG
TDP76,780,73476,780,755AAGGGTCTGCAGGCCTCGTCCT
TDR76,780,82576,780,844ATGAGCGGTCCAGCATGTAG

PCR Primers

PrimerSequence
SUATCCACCCAAGTGCTTTCTG
SDGCCTCCTCTAACACATTCGG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR78 bp++-
TDFTDR136 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
16218A-A6VGB6C57BL/6NTac
16218A-C4VGB6C57BL/6NTac
16218A-G6VGB6C57BL/6NTac
16218A-F1VGB6C57BL/6NTac