16734   Ybx1     Status: ES cell colonies screened / QC positives

GeneYbx1
Chromosome4
Deletion Start118,966,965
Deletion End118,951,547
Deletion Size15,419
Genome Build37
MGI IDMGI:99146
NCBI Gene ID22608
BAC ID361H19
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 4

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFTTGGCACAAAGCAGGTCAAG
TUPCAGGCGCGTCGCATGAGCCATG
TURAAGCGTGCTTAGCCTGGAGTTG
TDFCCCAGAAACTGGAGTTAGGGTTG
TDPTTGTGAGCCACCATGTGGGTGCTA
TDRGCCGGAGAAATGGCTCCATAG

PCR Primers

PrimerSequence
SUATACCAATGAGAGCGCAG
SDCCAGAACCAGAGCAGGTAAAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
16734A-C6VGB6C57BL/6NTac
16734A-D11VGB6C57BL/6NTac
16734A-F4VGB6C57BL/6NTac
16734A-G9VGB6C57BL/6NTac