17004   N4bp2l1     Status: ES cell colonies screened / QC positives

GeneN4bp2l1
Chromosome5
Deletion Start151,397,008
Deletion End151,375,252
Deletion Size21,757
Genome Build37
MGI IDMGI:2140872
NCBI Gene ID100637
BAC ID68C6
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 5

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF151,396,149151,396,169CCTGCCCTGCACTTGGTATTC
TUP151,396,115151,396,142CGTTGGACTGTTTCTCTCTCCTTGCTGG
TUR151,396,066151,396,086CAAAGGGTGACGGTGGGAAAG
TDF151,375,747151,375,765GCAGGGCAGCATGAGAAAC
TDP151,375,722151,375,746CGCAGCAGAGCTGTCGAAGTACCTT
TDR151,375,685151,375,705CCTCAGGAGACCAGGCAGAAG

PCR Primers

PrimerSequence
SUGCTTCCACAGTGACTGCAG
SDGTGGAGAGGCTGGATCTGTC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR104 bp++-
TDFTDR81 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17004A-B1VGB6C57BL/6NTac
17004A-H7VGB6C57BL/6NTac
17004A-C8VGB6C57BL/6NTac
17004A-C1VGB6C57BL/6NTac
17004A-H5VGB6C57BL/6NTac