17087   4932438H23Rik     Status: ES cell colonies screened / QC positives

Gene4932438H23Rik
Chromosome16
Deletion Start91,056,488
Deletion End91,055,697
Deletion Size792
Genome Build37
MGI IDMGI:1921637
NCBI Gene ID74387
BAC ID170B4
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 16

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF91,056,23591,056,256GCTGTAAGTCTATCCTGCCTTC
TUP91,056,20891,056,234TGCCATGGAGCAAACCAGCTATCATGG
TUR91,056,18691,056,207TGTGAACCAGATGGTCAGATGG
TDF91,055,99991,056,019TCATCCACAGCAGAAGGGAAG
TDP91,055,96091,055,989TGTACAAAGGCTGGCAAACATGTATGTTCA
TDR91,055,87991,055,900TGGCGAGGCTAGAAATGTTGTC

PCR Primers

PrimerSequence
SUTTAGTCAGCGTGCGTAGGTG
SDGCATTCTGAAAGAAGGTCCC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR71 bp++-
TDFTDR141 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17087A-D3VGB6C57BL/6NTac
17087A-F7VGB6C57BL/6NTac