17154   Lrig1     Status: ES cell colonies screened / QC positives

GeneLrig1
Chromosome6
Deletion Start94,649,676
Deletion End94,613,926
Deletion Size35,751
Genome Build37
MGI IDMGI:107935
NCBI Gene ID16206
BAC ID321K14
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 6

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF94,649,02894,649,045GGACGCAATGGCAGAGTG
TUP94,648,98994,649,017TGTTGGGATTGGGATCCATGGCTGTATCT
TUR94,648,95394,648,975CACCTAAGGGCTGGGTTACATAC
TDF94,614,32094,614,340GAGTGGCCCTGGACTTGATAC
TDP94,614,28794,614,316ACAAAGCATTTGGATTAGTACTGGCCCTTC
TDR94,614,25594,614,274ACCAACTGGCTAACCAACAC

PCR Primers

PrimerSequence
SUCACGGCTATCATCAGCTCAG
SDGCGAATTTGATCTCTTACAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR93 bp++-
TDFTDR86 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17154A-A3VGB6C57BL/6NTac
17154B-D2VGB6C57BL/6NTac
17154B-G11VGB6C57BL/6NTac
17154B-E6VGB6C57BL/6NTac