17548   Wars     Status: ES cell colonies screened / QC positives

GeneWars
Chromosome12
Deletion Start110,126,693
Deletion End110,098,452
Deletion Size28,242
Genome Build37
MGI IDMGI:104630
NCBI Gene ID22375
BAC ID178L13
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 12

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF110,126,558110,126,576TTGTCGGGCTCTCCGAAAC
TUP110,126,536110,126,557ATGCACCTCAGCCACCACGCCT
TUR110,126,478110,126,501GCCTCAGAAGCACATAAGAAGGAC
TDF110,099,425110,099,445AACCCACCCTGTCAAATCAAG
TDP110,099,397110,099,423CACACTCCCAATAGGCTTCTCACGTGG
TDR110,099,336110,099,359CATCAGAGAAGAAACAGCATCCAG

PCR Primers

PrimerSequence
SUTCTGGGCACTAGATGGGAAC
SDCACAATGATCCCTAGGAGCC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR99 bp++-
TDFTDR110 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17548A-A10VGB6C57BL/6NTac
17548A-H3VGB6C57BL/6NTac