17574   Arvcf     Status: ES cell colonies screened / QC positives

GeneArvcf
Chromosome16
Deletion Start18,405,355
Deletion End18,389,274
Deletion Size16,082
Genome Build37
MGI IDMGI:109620
NCBI Gene ID11877
BAC ID61M4
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 16

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF18,389,80318,389,827GGGCAGTTCCTTTAAGAGTGTAGTC
TUP18,389,83218,389,854CAGGCATGATCCCACCATCTGCC
TUR18,389,86218,389,884GGGAAACTGATGCTAGGTCACAG
TDF18,404,56518,404,583CAGTTGACCGGAGGGAGAG
TDP18,404,58518,404,608AGGACACTGGGCAGTGACTCCACA
TDR18,404,64318,404,662GGACACTTGCTTGCTGTTAC

PCR Primers

PrimerSequence
SUCTATGGCTCAGCTGTGCTTG
SDGCAAAGGAAGGCAAAGACAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR82 bp++-
TDFTDR98 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17574A-C6VGB6C57BL/6NTac
17574A-E6VGB6C57BL/6NTac
17574A-G1VGB6C57BL/6NTac
17574A-G3VGB6C57BL/6NTac
17574A-E4VGB6C57BL/6NTac