17711   Xiap     Status: ES cell colonies screened / QC positives

GeneXiap
ChromosomeX
Deletion Start39,458,257
Deletion End39,447,579
Deletion Size10,679
Genome Build37
MGI IDMGI:107572
NCBI Gene ID11798
BAC ID318N11
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome X

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF39,447,71939,447,740GCGAGCTGGGTTTCTTTATACC
TUP39,447,74339,447,768TGAAGGAGACACCGTGCAATGTTTCA
TUR39,447,79039,447,812AGCTGAGTCTCCATACTGCCATC
TDF39,457,51439,457,538AGCCCTCACATCGAAGCACTAAATC
TDP39,457,54139,457,564ACCTGTCCCACAGTAGAAGCAGCC
TDR39,457,58239,457,605GTTGAAAGGCATGGGTAATTCCAG

PCR Primers

PrimerSequence
SUTGAGAGAGAAACAGGCTGGG
SDCCAATTAAAGTCATTGGGCAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR94 bp++-
TDFTDR92 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17711A-B7VGB6C57BL/6NTac
17711A-C5VGB6C57BL/6NTac
17711A-G2VGB6C57BL/6NTac