17786   Asxl1     Status: ES cell colonies screened / QC positives

GeneAsxl1
Chromosome2
Deletion Start153,182,910
Deletion End153,172,073
Deletion Size10,838
Genome Build37
MGI IDMGI:2684063
NCBI Gene ID228790
BAC ID429L8
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 2

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFCCGATGTGAACCCTGAGTAGTG
TUPCAAACTACTAGAGTGCCCGGTGGGA
TURGAGCCCTAGTGCCAATGTTTG
TDFTCTTCAAGGTAGGAGACAAGTTTC
TDPTCACTCTGTAGGTCAGGCTGGCCT
TDRCCAGGTGTGGTGGCACATAC

PCR Primers

PrimerSequence
SUACCTCTGACCCCGTGGTTATG
SDGACTACAGCATCTCAGAGTAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17786A-C9VGB6C57BL/6NTac
17786A-E12VGB6C57BL/6NTac
17786A-A12VGB6C57BL/6NTac