17825   1110002N22Rik     Status: ES cell colonies screened / QC positives

Gene1110002N22Rik
Chromosome11
Deletion Start79,955,618
Deletion End79,950,306
Deletion Size5,313
Genome Build37
MGI IDMGI:1915800
NCBI Gene ID68550
BAC ID125P9
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 11

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF79,955,55179,955,570CCTGAGCACGAGGTGGATTG
TUP79,955,52379,955,546CCAGTCACTAGCCTGTAACCGGGA
TUR79,955,49879,955,516CGGACACAGGGCAGAAGAG
TDF79,950,97579,950,997GCATGGCTATAAGAGGCTTTGAC
TDP79,950,94979,950,973AGACCCTTGCAACCTGCAGAGTCCA
TDR79,950,87279,950,892CTGACTTCGAGACTCAGCAAC

PCR Primers

PrimerSequence
SUCTCCTCTCAACTCCGGACAG
SDGGCTCCTGTAGGTGTTCAGC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR73 bp++-
TDFTDR126 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17825A-B10VGB6C57BL/6NTac
17825A-H11VGB6C57BL/6NTac
17825A-C2VGB6C57BL/6NTac
17825A-G5VGB6C57BL/6NTac
17825A-D6VGB6C57BL/6NTac