17831   Fbxo47     Status: ES cell colonies screened / QC positives

GeneFbxo47
Chromosome11
Deletion Start97,740,875
Deletion End97,715,679
Deletion Size25,197
Genome Build37
MGI IDMGI:1920223
NCBI Gene ID72973
BAC ID435O7
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 11

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF97,740,28897,740,308TGCCTCTTTCCTCTCTCTGTC
TUP97,740,26397,740,287TCTTTATTCAACAGAAACACTTATT
TUR97,740,23797,740,257AGCCTGCTGCCTCTTGTAGTC
TDF97,715,77197,715,791GACGATGACAGAGGCTTCCTG
TDP97,715,74197,715,766TGTTCCATCTTCTCCATGCTCAGGCG
TDR97,715,71197,715,734GGTCAGATACAGCACCTCCTTATG

PCR Primers

PrimerSequence
SUACACAGGGTCTCAACAACCC
SDGCACTAGTCACTGAATGCGG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR72 bp++-
TDFTDR81 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17831A-A4VGB6C57BL/6NTac
17831A-F8VGB6C57BL/6NTac
17831A-H11VGB6C57BL/6NTac