17979   Arpc2     Status: ES cell colonies screened / QC positives

GeneArpc2
Chromosome1
Deletion Start74,314,429
Deletion End74,283,403
Deletion Size31,027
Genome Build37
MGI IDMGI:1923959
NCBI Gene ID76709
BAC ID385O17
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 1

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF74,283,67074,283,688GGAAGCAGCGAGAGGACAG
TUP74,283,69274,283,716CAAGGCGTGCCAGAGAACAGGAGAC
TUR74,283,74374,283,760TCTCGGGCGTGACTTCTG
TDF74,314,13474,314,153TCTGCTGGGAACATCCAGTG
TDP74,314,15474,314,179TGCTTATGGGCTTGCCATGGTGTTAC
TDR74,314,24474,314,265GCCCAAAGGAGACCAAACAAAG

PCR Primers

PrimerSequence
SUTGGTGGCTGCCTGCTACAG
SDAGCCACCCTTTCCTCTTCTC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR91 bp++-
TDFTDR132 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17979A-B3VGB6C57BL/6NTac
17979B-A8VGB6C57BL/6NTac