17996   Qars     Status: ES cell colonies screened / QC positives

GeneQars
Chromosome9
Deletion Start108,418,269
Deletion End108,410,417
Deletion Size7,853
Genome Build37
MGI IDMGI:1915851
NCBI Gene ID97541
BAC ID435D3
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 9

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF108,410,966108,410,984CAGGCACTGAGGCATGGAG
TUP108,410,986108,411,011TAGAGACCTCTGGTGTGGATTGCAGA
TUR108,411,012108,411,033GCAGGCTTCTCATTGTGGTAAC
TDF108,417,289108,417,310TGGCTACAGATTCCAGCACAAG
TDP108,417,314108,417,336CCCGAAGACCCTGTTGAAGTGCC
TDR108,417,351108,417,369CCTACCGGGTTCAGGTCAC

PCR Primers

PrimerSequence
SUGGATAGTGTCGGGTTCCTTG
SDAACTGGAAAGGCCACAACAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR68 bp++-
TDFTDR81 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
17996A-B4VGB6C57BL/6NTac
17996A-G3VGB6C57BL/6NTac