18000   Mis18bp1     Status: ES cell colonies screened / QC positives

GeneMis18bp1
Chromosome12
Deletion Start66,262,921
Deletion End66,234,437
Deletion Size28,485
Genome Build37
MGI IDMGI:2145099
NCBI Gene ID217653
BAC ID318P15
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 12

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF66,262,23966,262,258TGGGACCGAAGAGAGAGAAC
TUP66,262,21266,262,238TGCAGACATGGTATCAAATCCCAGCAC
TUR66,262,17666,262,197CAAACTTGAGGCCAACCTAGAC
TDF66,235,27166,235,293AAGCAGTACCAGCCTTATTACAC
TDP66,235,24666,235,269AAGCAAGTGACTAGACTTTTCTAA
TDR66,235,21766,235,236GCCGTTGCCATTATCCAAAC

PCR Primers

PrimerSequence
SUTGAATGTCAAACTGCTCGTC
SDGGCTTGTAATTTCAGGCTGC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR83 bp++-
TDFTDR77 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
18000A-C9VGB6C57BL/6NTac
18000A-D8VGB6C57BL/6NTac
18000A-E3VGB6C57BL/6NTac
18000A-C6VGB6C57BL/6NTac