18040   Arid2     Status: ES cell colonies screened / QC positives

GeneArid2
Chromosome15
Deletion Start96,209,381
Deletion End96,187,279
Deletion Size22,103
Genome Build37
MGI IDMGI:1924294
NCBI Gene ID77044
BAC ID91A16
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 15

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF96,188,13096,188,150GCGTAGCCTAGACATCACCTG
TUP96,188,15296,188,181TGTGTTTTGATGGTGTACTCATGCCCTGTA
TUR96,188,20396,188,223GAGGGTCACACGCACACTATG
TDF96,209,24596,209,266AACACTCCTATGCCACCTTCAC
TDP96,209,26896,209,292AGCTGTACAAGTGCAGGGCCAGCCT
TDR96,209,31296,209,330TGACTGGACGCACTGACTG

PCR Primers

PrimerSequence
SUTTGCTATGGCTTCATTGGTG
SDTACTAGCATGAAGCAATCGAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR94 bp++-
TDFTDR86 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
18040A-A9VGB6C57BL/6NTac
18040A-G8VGB6C57BL/6NTac
18040A-C11VGB6C57BL/6NTac
18040A-E10VGB6C57BL/6NTac
18040A-D7VGB6C57BL/6NTac
18040A-B10VGB6C57BL/6NTac