18115   Xbp1     Status: ES cell colonies screened / QC positives

GeneXbp1
Chromosome11
Deletion Start5,424,958
Deletion End5,421,001
Deletion Size3,958
Genome Build37
MGI IDMGI:98970
NCBI Gene ID22433
BAC ID98O8
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 11

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF5,421,3855,421,405CCGACACAGGCACAGAAGAAG
TUP5,421,4095,421,430CCCGACGCCCAGTCCTCTGTAA
TUR5,421,4385,421,460TCCTACCCTACGACCACAAAGAG
TDF5,424,3125,424,330AGGTGCAGGCCCAGTTGTC
TDP5,424,3365,424,364CCCAGAACATCTTCCCATGGACTCTGACA
TDR5,424,4005,424,420CACACGCCACTTAGGCTACAG

PCR Primers

PrimerSequence
SUGGACTCCAGCAACCAGTG
SDTAGGCAATGTGATGGTCAGG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR76 bp++-
TDFTDR109 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
18115A-H7VGB6C57BL/6NTac
18115A-C11VGB6C57BL/6NTac
18115A-A9VGB6C57BL/6NTac
18115A-F6VGB6C57BL/6NTac