18153   Mcm10     Status: ES cell colonies screened / QC positives

GeneMcm10
Chromosome2
Deletion Start4,931,738
Deletion End4,912,386
Deletion Size19,353
Genome Build37
MGI IDMGI:1917274
NCBI Gene ID70024
BAC ID41H4
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 2

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF4,931,6354,931,653GGGAGCCAGGACTGCTTAG
TUP4,931,6014,931,630TTACATCCAACTTACATGTCAGACCAGGGA
TUR4,931,5794,931,599GAGTCAGACCACCCAGTTCAG
TDF4,912,7174,912,738CCTGTTCCTTCAGGGTCTCATC
TDP4,912,6884,912,716CCCAGTGGTTTAAGAACTCCCACAAGTCC
TDR4,912,6324,912,651TTCCCAGGGCCATCTGTTAC

PCR Primers

PrimerSequence
SUTGTCTCTCCTGCTTCAATGG
SDTCAACAGAAGGAAACCCTGG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR75 bp++-
TDFTDR107 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
18153A-H12VGB6C57BL/6NTac
18153A-B2VGB6C57BL/6NTac
18153A-D1VGB6C57BL/6NTac
18153A-G9VGB6C57BL/6NTac
18153A-G1VGB6C57BL/6NTac
18153A-B1VGB6C57BL/6NTac