18308   2900026A02Rik     Status: ES cell colonies screened / QC positives

Gene2900026A02Rik
Chromosome5
Deletion Start113,530,591
Deletion End113,521,427
Deletion Size9,165
Genome Build37
MGI IDMGI:1920194
NCBI Gene ID243219
BAC ID170F15
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 5

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFCAGTCAGGAGCGTGCAGAG
TUPTAGGCAGACCCACAGGGACAGACA
TURCAGCAGTGTTCCAGTTTACTATGTC
TDFCCTCCGCACATGGATAGAAAC
TDPAGGCACCCAGCCTCCTCTTATGTTTGG
TDRGCCTCCTGACTCGCCTAAG

PCR Primers

PrimerSequence
SUCTGGTGAAGCCTTATGCC
SDAGGTGGATGCCAAGAGTCTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
18308A-B10VGB6C57BL/6NTac
18308A-D3VGB6C57BL/6NTac
18308A-G4VGB6C57BL/6NTac