18317   Fam63a     Status: ES cell colonies screened / QC positives

GeneFam63a
Chromosome3
Deletion Start95,099,699
Deletion End95,091,873
Deletion Size7,827
Genome Build37
MGI IDMGI:1922257
NCBI Gene ID75007
BAC ID380A1
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 3

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUF95,092,34295,092,361TGCTGGGCAGGTAAGATGTC
TUP95,092,36295,092,389CACAGATGTGCCTTCCAAAGATGCTTGC
TUR95,092,40295,092,424GCGTGGTCTTGTAAGGAATTGTC
TDF95,099,30095,099,321CAACAGCAAGCAGTTCAACCTG
TDP95,099,32295,099,342TGCGAACAAGGGCTCCTTCGC
TDR95,099,36295,099,381AGCTCCCTTGCCGACCAAAG

PCR Primers

PrimerSequence
SUTCTTTCAGGGAAGAAGCCAG
SDCCAAGGTAGGAACGCAAATC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
TUFTUR83 bp++-
TDFTDR82 bp++-
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
18317B-B11VGB6C57BL/6NTac
18317A-H7VGB6C57BL/6NTac