18714   1300018J18Rik     Status: ES cell colonies screened / QC positives

Gene1300018J18Rik
Chromosome15
Deletion Start88,930,489
Deletion End88,919,542
Deletion Size10,948
Genome Build37
MGI IDMGI:1919007
NCBI Gene ID223776
BAC ID314F10
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 15

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFCCCTACGTCCAAACTCCATGAATG
TUPTAGGTGGAGGAAGACAAAGAAACTGGCA
TURTAAGCCCGTTCTTGCCACTC
TDFTGGTGGCTTACGGGCTTTC
TDPAACAACCCAGAGGCTGGTTATGCAA
TDRTGCCATTTCCTCTTGATGGTTAC

PCR Primers

PrimerSequence
SUGGTGCACAGGTGCCAGAAG
SDTGCTTCGCATCAACTTCAAC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
18714A-C8VGB6C57BL/6NTac
18714A-D7VGB6C57BL/6NTac