18716   1700003M02Rik     Status: ES cell colonies screened / QC positives

Gene1700003M02Rik
Chromosome4
Deletion Start34,675,195
Deletion End34,658,533
Deletion Size16,663
Genome Build37
MGI IDMGI:1916579
NCBI Gene ID69329
BAC ID212B15
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 4

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFGACTGAGGTACTTAGGTTGTTGCTG
TUPCTGGGCTCCCTCCCTTGGCTTTC
TURGTGGCACTTACTCTGACATGGAG
TDFGGCTGGAGCACAGAAACAGATAG
TDPAGGGCTTGTAGGCTGTCAGCGAAACT
TDRGCACAGGACCCAAAGTCAGTTC

PCR Primers

PrimerSequence
SUTTCAGAGTCTGCAAAGCGTC
SDTTTCCTGGGCATCATATGATG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
18716A-C11VGB6C57BL/6NTac
18716A-D6VGB6C57BL/6NTac
18716A-D12VGB6C57BL/6NTac
18716A-F6VGB6C57BL/6NTac
18716A-H3VGB6C57BL/6NTac