18882   L2hgdh     Status: ES cell colonies screened / QC one positive

GeneL2hgdh
Chromosome12
Deletion Start70,825,780
Deletion End70,793,274
Deletion Size32,507
Genome Build37
MGI IDMGI:2384968
NCBI Gene ID217666
BAC ID374P5
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 12

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFGCCATAGGAAAGGCAGTGTTG
TUPTTGAGGTCCGGAGCTAATCTGGCTC
TURGGTTAAGAAATGGAGAGGAGTTGTG
TDFCGGAGGGACTGGCGAGATTG
TDPCAGACCGCGTCCTTCATGTGAGAAATGC
TDRAAGTGGCAGCAGGCGAAGG

PCR Primers

PrimerSequence
SUAGCAGGGTAGTGACAGGGAG
SDGCACTGCTAGTCACGTGGAG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
18882A-D10VGB6C57BL/6NTac