19245   0610007P14Rik     Status: ES cell colonies screened / QC positives

Gene0610007P14Rik
Chromosome12
Deletion Start87,163,167
Deletion End87,157,060
Deletion Size6,108
Genome Build37
MGI IDMGI:1915571
NCBI Gene ID58520
BAC ID365L20
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 12

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFTCTGGTGCCTAATCCAGTCTTG
TUPAGCCACTTGTACAGCAGTTCTCAACCTG
TURTTGTTTGACTCCCAAAGGGTTATG
TDFAATGTCCTTTCCCGTTTCTGTC
TDPTGTTCCCTTGCAGACTCTATCACATCACA
TDRCAGGGCGAGGAGGAATGTC

PCR Primers

PrimerSequence
SUTGCTGCAAGGTGTACTGGTC
SDCCTCTCGAAAGCTTAAGATGC
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
19245A-A2VGB6C57BL/6NTac
19245A-E11VGB6C57BL/6NTac
19245A-H9VGB6C57BL/6NTac
19245A-H12VGB6C57BL/6NTac