19304   Blzf1     Status: ES cell colonies screened / QC positives

GeneBlzf1
Chromosome1
Deletion Start166,236,606
Deletion End166,222,341
Deletion Size14,266
Genome Build37
MGI IDMGI:1201607
NCBI Gene ID66352
BAC ID397L18
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 1

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFTGGAGTAGGAGGGCGTTATTTG
TUPTTTCTCTGGGTTGCCTTGGCTGC
TURGCTCTCTGAGTTCAAGGCCAATG
TDFCCTGGGAGCGCCTTTGAATC
TDPTGCAACTATAGGAAAGGGAGCCCGA
TDRCAGAAGCAGCAGGGAAGGAAG

PCR Primers

PrimerSequence
SUGTCCCAGCGAAGTTTCTGAC
SDCAATGCATGGTTGGAGTTTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
19304A-E10VGB6C57BL/6NTac
19304A-E12VGB6C57BL/6NTac
19304A-G9VGB6C57BL/6NTac