19426   Dcx     Status: ES cell colonies screened / QC one positive

GeneDcx
ChromosomeX
Deletion Start140,365,844
Deletion End140,357,635
Deletion Size8,210
Genome Build37
MGI IDMGI:1277171
NCBI Gene ID13193
BAC ID358J9
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome X

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFGAGAGGGTCACGGATGAATGG
TUPTTCCAAGTCCCACTCATAGTGCCCA
TURCCTGCAAGGTTCTGGTTCTGTAG
TDFGCGCGTGCTTCTCAACAAG
TDPACAGCCCACTCTTTCGAGCAGGTCC
TDRCCAGTTTGATCGCTTCTGTGATG

PCR Primers

PrimerSequence
SUCATTCAGTCCTCAGCCTAC
SDGATAGAGTGTCAGTTAAGGATG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
19426A-F10VGB6C57BL/6NTac