19758   Amotl1     Status: ES cell colonies screened / QC positives

GeneAmotl1
Chromosome9
Deletion Start14,419,223
Deletion End14,379,600
Deletion Size39,624
Genome Build37
MGI IDMGI:1922973
NCBI Gene ID75723
BAC ID428j10
BAC LibrarybMQ
CassetteZEN-Ub1
Clones AvailableYes

Primer Genomic Coordinates on Chromosome 9

Please be aware that these oligonucleotides have been validated only by Taqman assay.

PrimerStartEndSequence
TUFCGTGACATTTGTGGCAGACAG
TUPAAGTGGAACCTCGGCCCGTGACG
TURGGGACTTGGAGAAGGTGAGAC
TDFAGCTTGGACCGGATGCCTTTG
TDPCGATTGTGGAGCGAGCCCAGCAAAT
TDRAAGCACACGGTTCTCCTCTG

PCR Primers

PrimerSequence
SUGGAGGCATATTCCAGCAAAG
SDGAGCAGCTGGTGAGTCCTG
LacInRTTGACTGTAGCGGCTGATGTTG
LacInfGGTAAACTGGCTCGGATTAGGG
NeoInRTACTTTCTCGGCAGGAGCAAGGTG
NeoInFTTCGGCTATGACTGGGCACAACAG
LacInZRevGTCTGTCCTAGCTTCCTCACTG
NeoFwdTCATTCTCAGTATTGTTTTGCC

Predicted PCR Products

Forward PrimerReverse PrimerLengthWTHETKO
SULacZRev bp-++
NeoFwdSD bp-++
LacInfLacInR210 bp-++
NeoInfNeoInR282 bp-++

Available Clones

ES Cell ordering information can be found at the KOMP Repository.
Clone NameParental ES CellMouse StrainCassette Copy Number
19758A-C4VGB6C57BL/6NTac
19758A-C7VGB6C57BL/6NTac
19758A-C12VGB6C57BL/6NTac
19758A-E12VGB6C57BL/6NTac